IRKUTSK, RUSSIA
Institute of Plant Physiology and Biochemistry
Russian Academy of Sciences

NOVOSIBIRSK, RUSSIA
Institute of Cytology and Genetics
Russian Academy of Sciences

The new member of superoxide dismutase gene family in maize — iron superoxide dismutase

— Katyshev, AI; Klimenko, ES; Chernikova, VV; Kobzev, VF; Konstantinov, YM

Superoxide dismutases (superoxide:superoxide oxidoreductase, EC 1.15.1.1; SOD) are the first line of cellular defense against toxic reactive oxygen species (ROS) in virtually all living organisms. These ubiquitous enzymes are classified into three groups based on the metal co-factor used by enzyme: iron SOD (FeSOD), manganese SOD (MnSOD), and copper/zinc SOD (Cu/ZnSOD). In plant cells multiple SOD isoforms distributed in all subcellular locations where ROS formation can occur, including mitochondria, chloroplasts, microsomes, glyoxysomes, peroxisomes, apoplasts, and the cytosol. It is well established that the major sources for ROS formation are electron transport chains of chloroplasts and mitochondria in plant cells. Therefore, it is not surprising to find several SOD isoforms in these compartments. As for maize, to date the Sod gene family has been well characterized by Scandalios group (for review see Fink and Scandalios, Arch. Biochem. Biophys. 399(1):19–36, 2002). But, in fact, at least one intriguing question still was not explained. In maize mitochondria four MnSOD isoforms function, but chloroplasts contain only one Cu/ZnSOD isoform. It has been found early that for a number of plant species FeSODs and Cu/ZnSODs could coexist in chloroplasts. FeSOD genes, as well accepted, originated in plastids and moved to the plant nuclear genomes during evolution. The fact that for some plant species FeSOD genes are still not found is explained by presumption that FeSOD function in chloroplasts was replaced by the same of Cu/ZnSOD. In this report we firstly present data showing that this hypothesis is wrong for the case of Zea mays SOD gene family.

Total RNA isolation for cDNA synthesis from 3-day-old etiolated maize seedlings of hybrid VIR46MV was performed by QIAGEN RNeasy Mini Kit according manufacturer’s instructions. cDNA synthesis was made with Promega Universal RiboClone cDNA Synthesis System. To generate specific primers for FeSOD transcripts a multiple alignment of all known plant FeSOD gene sequences was made. Two oligonucleotides corresponding to highly conservative regions of FeSOD genes were used in our work as PCR primers: Fsdc1: 5′ — TGGATGCTTTGGAACCACATATGAG — 3′ and Fsdc2: 5′ — TCAAGGTAGTACGCATGCTCCCA — 3′. Polymerase chain reaction with these oligonucleotides as primers and maize cDNA as a template resulted in approximately 500 bp single product formation. The PCR-fragment was partially sequenced (378 bp) and was refered by sequence homology as a part of FeSOD mRNA sequence. A quick search for highly similar nucleotide sequences by BLAST services at the NCBI server indicated a higher degree of homology of our sequence (GenBank/EMBL accession number AJ854254) with rice (Oryza sativa) FeSOD mRNA sequences(85%, GenBank acc. numbers: XM_550626, XM_493744, AK071301, AK062073, AB014056) and 95% identity with Zea mays CL8780_2 mRNA sequence (GenBank acc. number AY112450). These data strongly suggest that as obtained in our experiments partial cDNA sequence as Zea mays CL8780_2 mRNA sequence should be referred as Zea mays FeSOD partial mRNAs. The analysis of deduced amino acid sequence showed that amino acids from 1 to 58 compose a part of characteristic for Fe and Mn SOD N-terminal domain and from 59 to 125 — are a part of C-terminal domain. This sequence contains one of four metal ligand — His49.

We could not found any articles reporting the existence of FeSOD gene transcripts in maize except the enzyme activity assay data (Pastori et al., J. Exp. Bot. 51(342): 107–113. 2000). According to these authors, FeSOD activity in maize mesophyll cells is chilling-induced. Therefore, we performed Nothern-hybridization of electrophoretically separated and equalibrated RNA samples from 3-day-old etiolated maize seedlings incubated for 1–24 hours at 27°C (control), 16°C, and 4°C with FeSOD-specific radiolabeled probe. Results of such an experiment are presented at Figure 1. These results allow us to make preliminary suggestion that the FeSOD transcription level in Zea mays seedlings also increases at sub-optimal temperatures.

Therefore we showed the presence of mRNA for novel Sod gene, encoding FeSOD isoform in maize seedlings. The enzyme presumably functions within maize chloroplasts. Our preliminary results suggest that this gene transcription is chilling-induced.

 

Figure 1. The influence of temperature on the transcript level of FeSOD gene in maize seedlings.


Please Note: As is the policy with the printed version, notes submitted to the Maize Genetics Cooperation Newsletter may be cited only with consent of the authors.

Return to the MNL Volume 79 Index
Return to the index of Maize Newsletters
Return to the Maize Genome Database Page