MOSCOW, RUSSIA

Institute of Agricultural Biotechnology

 A putative transposed K-box homolog of zmm1 and zag2 --Ermishev, VY, Karyagina, AS, Khavkin, EE, Naroditskii, BS, Zabrodina, MV Previously we reported (MNL 73: 70, 1999) that the direct amplification of genomic DNA with degenerate primers recognizing the K-box sequence of the MADS-box genes produced DNA bands similar in size to the product of cDNA amplification. A 190-bp amplicon belonging to the agamous class was cloned from the A188 inbred, sequenced, and compared to maize agamous genes using the program BLAST 2.0.9 (Altschul et al., Nucl. Acids Res. 25: 3389, 1997). The nucleotide sequence of this K-box fragment was 90-94% identical to that of zmm1 (nucleotides 3693-3758 and 4213-4332) and zag2 (nucleotides 4760-4825 and 5269-5321).

Several sequences corresponding to the MADS-box motif (exon 1) were previously related to mobile elements (Fisher et al., Nucl. Acids Res. 23: 1901, 1995; Mena et al., Plant J. 8: 845�854, 1995; Montag et al., Nucl. Acids Res. 23: 2168, 1995). Following Fischer et al., 1995, we tentatively define the reported amplicon as a transposed K-box element of Zea mays (tkz1).

The putative transposed element comprises most of exons 3 and 5, a very short stretch of intron 3, and a longer fragment of intron 4 (Figure 1). The nucleotide and deduced amino acid sequences of exon 3 in tkz1 are 90 and 95% identical to those of zmm1 and zag2. Exon 5 contains a two-nucleotide insert; as a result, the corresponding identities of the nucleotide and amino acid sequences are 90 and 50%. A 6-bp stretch of intron 3 adjoining exon 3 is completely identical to the corresponding sequences in zmm1 and zag2. The sequence downstream is 87% identical to intron 4 of zmm1, with a 17-bp stretch completely identical to nucleotides 4213-4229 of zmm1 and a 12�bp stretch bounding exon 5, which is completely identical to nucleotides 4281-4292 in zmm1 and to nucleotides 5269-5280 in zag2.

tkz1 1 ctaccagcaggaatcaccaaagctgcgcaaccagatccagatgctgcaaa-caactaacaggtagag 66

zmm1 3693 *********a*****cgt***a****************************a**-*************3758

zag2 4760 *********a******g****a****************************a**-************* 4825

tkz1 67 ttctgatgtaagtaacttagagttcgtgtaggctaggttgtttatttgtcagactctaattgattgaa 136

zmm1 4213 *****************at*****t***at***************************g****c***** 4280

tkz1 137 ttcttgtttcagagtgagctgctgtctgctgagattgc-ttacatggcaaaaag 190

zmm1 4281 ************************g****c*****--*a*********_***** 4332

zag2 5269 ************************g****g*****--*g*********_***** 5321

Figure 1. Alignment of tkz1 to the corresponding sequences of zmm1 and zag2 (GenBank accession numbers X81199 and X80206). Exons 3 and 5 are in bold. Identical residues are indicated by asterisks.
 
 

Please Note: Notes submitted to the Maize Genetics Cooperation Newsletter may be cited only with consent of the authors.

Return to the MNL 74 On-Line Index
Return to the Maize Newsletter Index
Return to the MaizeGDB Homepage