Polymorphic microsatellites found in cDNA clones
--Senior, L; Lee, M

To date, 33 polymorphic microsatellite markers have been developed by screening sequenced RFLP probes obtained from the UMC, BNL, NPI and PHP public probe libraries (Senior and Chin). An additional 32 putative microsatellite-containing probes were identified from the same libraries by dot-blot hybridizations, but have not yet been sequenced. Given the large number of probes available to the public, screening RFLP probe libraries should provide a rapid method for the development of microsatellite markers. All of the probes screened thus far were derived from maize genomic libraries, however, many of the publicly available RFLP probes are derived from cDNA libraries. Although cDNA probes may contain microsatellite regions, we would not expect them to be polymorphic. To test this hypothesis, 122 cDNA clones from the ISU clone library (Pereira et al., Genome 37:236-243, 1994) were probed with the following oligos: CTx10, GAAx5, CCTx5 and GTCx5. The screening was done by PCR amplification of the cDNA probe insert from the plasmid using an aliquot of the bacterial culture as template, followed by electrophoresis of the products on a 0.8% agarose gel. A Southern blot of the gel was made and used in the hybridizations. The blots were probed with a mixture of all four oligos. Three probes showed a strong positive hybridization signal and were subsequently sequenced. The probes contained the following repeats: ISU62 (AGC x5), ISU76 (GGT x 5) and ISU89 (AG x 5, AC x 5, GTGTC x 3, GTC x 5). Primers were designed to flank each of the six potential microsatellite regions as described in Senior and Heun (Genome 36:884-889, 1993). Amplification of the microsatellite region was then performed as described in Senior et al. (Crop Sci 36:1676-1683, 1996). No amplification products were obtained from the GTC repeat in ISU89. A monomorphic product was obtained from the GGT repeat in ISU76. The remaining 4 microsatellites looked promising after the initial screen and were subsequently run against a panel of 96 elite US maize inbreds and sized on 4% Metaphor agarose gels. The loci were then mapped using a Mo17 x B73 recombinant inbred population (seed provided by C.W. Stuber). Locus names were assigned following the conventions described in Senior et al. (1996). Results of the screening and mapping are shown in Table 1. Primer sequences are shown in Table 2. Although this study is preliminary, it shows that polymorphic microsatellite regions do occur in maize cDNA clones and can provide another source for the development of microsatellite-based markers.

Table 1. Number of alleles found, product size range and map location for microsatellites derived from ISU cDNA probes.
 

Locus name	Source	Bin No.	Repeat type	No. of alleles	Product size (bp)
nc130	ISU62	5.00	AGC/GCT	2	140-143
nc131	ISU89	2.04	AC/GT	4	135-147
nc132	ISU89	2.04	AG/CT	3	214-234
nc133	ISU89	2.04	GTGTC/GACAC	3	110-120

Table 2. Primer sequences for microsatellites derived from ISU cDNA probes.
 

Locus name	Forward Primer (5' - 3')	Reverse Primer (5' -3')
nc130	GCACATGAAGATCCTGCTGA	TGTGGATGACGGTGATGC
nc131	TTTCTTCGATCCCATGTCAC	TAGTGTGCTAGAACGTGCGC
nc132	TCATCTTGCTCTGATGCTCG	TGTGGGGGCACGTTAATTAC
nc133	AATCAAACACACACCTTGCG	GCAAGGGAATAAGGTGACGA

Return to the MNL 71 On-Line Index
Return to the Maize Newsletter Index
Return to the MaizeGDB Homepage