Mu9, a candidate for the regulator of Mutator activity, encodes two head-to-head transcripts

--R. Jane Hershberger, Christine A. Warren and Virginia Walbot

Mu9 is a 4942bp Mu element that is a candidate for the autonomous Mutator element (Hershberger, RJ et al., Proc. Natl. Acad. Sci. USA 88:10198-10202, 1991). Based on its restriction map and the sequence of its ~215bp terminal inverted repeats (TIRs), Mu9 appears to be similar or identical to Mu R1 (Chomet, P et al., Genetics 129:261-270, 1991) and Mu A2 (Qin, M et al., Genetics 129:845-854, 1991), other candidates for the autonomous element whose sequences have not yet been reported. Mu9 encodes two transcripts of ~2.8kb (gene A) and 1kb (gene B), diagrammed in Figure 1.
 
Figure 1. Structure of the Mu9 transcripts and open reading frames

We have isolated cDNA clones covering 2.6kb of gene A; we are missing the 5' end of the gene and the initiation codon. The truncated cDNAs encode an 813 amino acid open reading frame, and in the genomic Mu9 sequence there is an ATG in frame 10 amino acids upstream of the beginning of the cDNA clone. Gene A has at least two introns, one of 145bp near the 5' end, the other of 79bp near the 3' end. Gene B also has two short introns, of 117 and 72bp, both near its 5' end. The cDNAs we have isolated for this transcript encode a 207 amino acid polypeptide, beginning with an ATG at base 4476 (numbering according to Hershberger et al., 1991). There is an untranslated leader of 141bp that includes all of the first exon; this leader does not contain any ATG codons.

The gene B transcript begins just at the inside edge of the 215bp TIR-B, which implies that the gene B promoter is contained within the TIR. TIR-A and TIR-B are 96% similar overall, with only two differences in the first 180bp. On RNA blots, the message levels of gene A and gene B seem to be approximately equal; therefore, we postulate that TIR-A contains the promoter for gene A.

The premise that both Mu9 TIRs contain promoters implies that transcription stop sites or strong polyadenylation signals should lie between the Mu9 transcription units; otherwise, Mu9 would make antisense as well as sense copies of its genes. The ~350bp region of Mu9 that separates the two messages (black box in Figure 1) contains a series of four different direct repeats, ranging from 11 to 27bp, that are repeated two to five times each. The sequence between the termini of the cDNAs for gene A (3209) and gene B (3575) is given below, with the four types of repeats shown in different typefaces:

ACTGCTACGAACAAACACTATGAAACCTCCACCTGTATTGGTTGTAAGACTGCTAAGAACAAGCCCAG TGTATTTGTTGTAAGACTGCT CAGTTTTAGTT GCCAGTTCGTTGCTTCCCAGGTT CAGTTTTATTT CAGTTTTATTT CAGTTTTATTT CAGTTTTATTC ATCAG GCCCAGTTTCAG AGAAACAGATTGCTT GCCCAGTTCAGAGAAACAGATTGCTT GCAATTGTC GCCCAGTTCAG AGAAACAGATTGCTT GCCCAGTTTCAGAGAAATAGAGCGCAGAAAACAGATAAAATATAACAC AAAACAGATAACATATAACAC ACATGAATAACACTGAGCCATTAGTTCTTACAACCTCA

Although none of these motifs corresponds exactly to the polyadenylation consensus sequence, this region probably constitutes a series of either polyadenylation signals or transcription termination signals for the nascent RNAs. The structure of transcription termination regions is not well understood in plants, and studying this region may provide some new insight into this aspect of RNA processing.

Please Note: Notes submitted to the Maize Genetics Cooperation Newsletter may be cited only with consent of the authors

Return to the MNL 66 On-Line Index
Return to the Maize Newsletter Index
Return to the MaizeGDB Homepage